© Comparative Cytogenetics, 2010. Vol. 4, No. 2, P. 111-121.

ISSN 1993-0771 (Print), ISSN 1993-078X (Online)

Histone H3 gene in the Pacific oyster,
Crassostrea gigas Thunberg, 1793: molecular and
cytogenetic characterisations

K. Bouilly', R. Chaves’, M. Fernandes’, H. Guedes-Pinto*

Institute for Biotechnology and Bioengineering, Centre of Genomics and Biotechno-
logy, University of Tras-os-Montes and Alto Douro, (IBB/CGB-UTAD), Apartado
1013, 5001-801 Vila Real, Portugal.

E-mails: 'kbouilly@yahoo.fr, *rchaves@utad.pt, *marymgf@gmail.com, *h.gp@hot-
mail.com

Abstract. The Pacific oyster, Crassostrea gigas Thunberg, 1793 (2n = 20) is an
economically important mollusc species cultured throughout the world. The most
frequently used technique for molecular cytogenetic studies is fluorescence in situ
hybridisation which offers new opportunities for the identification of oyster chromo-
somes. In oysters, it has been used to locate telomeric sequences, satellite DNA, sim-
ple sequence repeats, ribosomal RNA genes, and bacteriophage P1 clones. However,
regarding chromosome identification, no study has been done with histone H3 gene.
Histone H3 is among the most conserved eukaryotic proteins. Most histone H3 genes
are repeatedly organised into clusters, which make them an ideal chromosomal mark-
er. In bivalves, some data exist concerning sequence information but little knowledge
is available concerning the physical mapping of histone genes. The histone H3 gene
was sequenced in C. gigas and phylogenetic analysis revealed that C. gigas was more
closely related to Ostrea edulis Linnaeus, 1758 and species of the genus Mytilus Lin-
naeus, 1758. In C. gigas, the histone H3 gene was mapped on two different pairs of
chromosomes, one at an interstitial site on the long arm of chromosome pair 4, and the
other on the telomeres of the smaller chromosome pair (pair 10). Polymorphism was
detected on the telomeres of pair 10, once it was possible to observe single or double
signals. Comparative chromosomal mapping should improve our understanding of
bivalve genome organisation.

Key words: bivalves, Crassostrea gigas, fluorescence in situ hybridisation, histone
H3 gene, phylogenetics, physical mapping.

INTRODUCTION

The Pacific oyster, Crassostrea gigas
Thunberg, 1793, is an economically important
oyster species cultured throughout the world.
This species has a diploid chromosome
number of 2n = 20, and all chromosomes
are metacentric. Several banding tehniques

http://pensoftonline. net/compcytogen
dot: 10.3897/compcytogen.v412.32

were already applied to oyster chromosomes.
They are very useful for the identification
of individual chromosomes and _ also
of particular regions of chromosomes.
“Classical” cytogenetic banding (G-, C- and
NOR (nucleolus organiser regions) - banding
techniques) was already performed in several
species of the genus Crassostrea Sacco, 1897

? Comparative
\4 Cytogenetics

jib

(review in Leitao, Chaves, 2008). Molecular
cytogenetic banding was also applied to
several species of the genus Crassostrea
(review in Leitéo, Chaves, 2008). RE
(restriction endonucleases) - banding (Leitao
et al., 2004, 2007; Bouilly et al., 2005; Cross
et al., 2005) and FISH (fluorescence in situ
hybridisation) technique with different kinds
of labelled probes were already produced in
different species of the genus Crassostrea.
FISH is a rapid and reliable technique for
chromosome identification, gene mapping,
localisation of gene expression, and analysis
of chromosome rearrangements in a wide
variety of genomes. Different probes have
already been applied successfully to species
of the genus Crassostrea: telomeric sequences
(Guo, Allen, 1997; Wang, Guo, 2001; Cross et
al., 2005), satellite DNA (Clabby et al., 1996;
Wang et al., 2001), simple sequence repeats
(Cross et al., 2005; Bouilly et al., 2008),
ribosomal RNA genes (Zhang et al., 1999; Xu
et al., 2001; Cross et al., 2003, 2005; Wang et
al., 2004, 2005a), and bacteriophage P1 clones
(Wang et al., 2005b).

DNA sequences of nuclear and
mitochondrial genes (Boudry et al., 2003;
Reese et al., 2008), including repetitive
satellite DNA sequences (Lopez-Flores et al.,
2004) have been variously used to examine the
phylogenetic relationships between oysters.

Histone proteins are the major constituents
of the eukaryotic chromatin. The family of
histone proteins has been subdivided into the
core histones (H2A, H2B, H3, and H4), which
form the core particle of the nucleosome, and
the linker histones (H1), which are involved in
the generation of the higher-order chromatin
structure (Thoma et al., 1979). Histone H3 is
one of the most conserved eukaryotic proteins
(Miller et al., 1993) and is an excellent probe
for chromosome mapping as histone genes
are usually organised in clusters (Maxson et
al., 1983). Histone gene mapping has been

Comparative
4 Cytogenetics

A

K, Bouilly et al.

achieved in a few species. In bivalves, little
knowledge is available concerning the physical
mapping of histone genes. Only five species
were studied until now: a mussel (Eirin-Lopez
et al., 2002, 2004) and four scallops (Zhang
et al., 2007). In Mytilidae, FISH experiments
on Mytilus galloprovincialis Lamarck, 1819
chromosomes revealed the presence of three
pairs of signals in three chromosome pairs
with the linker histone H1 probe (Eirin-Lopez
et al., 2002), and two pairs of signals in two
chromosome pairs with a core histone gene
probe (Eirin-Lopez et al., 2004). In Pectinidae,
histone H3 gene was clustered at two different
loci in the genome of Patinopecten yessoensis
Jay, 1857 or a single locus in the genome
of Chlamys farreri Jones et Preston 1904,
Chlamys nobilis Reeve, 1852, and Argopecten
irradians Lamarck, 1819 (Zhang et al., 2007).
Regarding mollusc molecular phylogenetic
studies using histone genes, little information
is available. No studies were realised in
Ostreidae, but some studies have already been
performed in Pectinidae (Puslednik, Serb,
2008), Mytilidae (Eirin-Lopez et al., 2004),
Veneridae (Kappner, Bieler, 2006) and in
gastropods (Colgan et al., 2000).

In the present work, we partially sequenced
the histone H3 gene in C. gigas and used that
data to ascertain the phylogenetic relationships.
We also applied FISH technique with histone
H3 gene probe in order to determine its location
and distribution in the genome of C. gigas.

MATERIAL AND METHODS

Animal material and genomic DNA
extraction. DNA was extracted from muscle
tissue preserved in 70% ethanol using the
Quickgene DNA tissue kit S (Fujifilm Life
Science). Tissue was sampled from adult
oysters bred at the IFREMER (Institut
Fran¢ais de Recherche pour |’Exploitation de

Comp. Cytogenet., 2010 4(2)

Histone H3 gene in the Pacific oyster, Crassostrea gigas

la Mer) hatchery in La Tremblade (Charente-
Maritime, France).

For chromosome preparations, embryos
were used. Gametes were collected by strip-
spawning sexually mature animals. Fertilized
gametes were cultured at 23°C in 150-L
fibreglass larval tanks of seawater.

PCR. PCR amplification of _ the
histone H3 gene was realised using
a pair of primers (forward: 5’-

CGTAAATCCACTGGAGGCAAGG-3’;
reverse: 5’-GGATGGCGCACAGGTTGGT
GTC-3’) designed from the H3 nucleotide
sequences of Pecten jacobaeus Linnaeus,
1758 and Mimachlamys varia Linnaeus, 1758
retrieved from GenBank (AY070153 and
AY070154 respectively). The PCR reactions
used were the standard ones, except that in the
labelling PCR we also used digoxigenin-11-
dUTP (Roche Molecular Biochemicals). PCR
was performed under the following conditions:
5 min denaturation at 94°C, 30 cycles of 1
min at 94°C, 40 s at 66°C and 1 min at 72°C,
and a final extension of 5 min at 72°C. PCR
amplification products were subjected to 1.5%
agarose gel electrophoresis and stained with
ethidium bromide.

Sequencing of histone H3 gene in
Crassostrea gigas, sequence and phylogenetic
analyses. The PCR amplification product
was excised from a 1.5% agarose gel
and purified using the Geneclean II Kit
(QBioGene MP Biomedicals). A band of
~ 300 bp was obtained. The purified PCR
product was sequenced in both directions
using the primers H3 forward (5’-CGT
AAATCCACTGGAGGCAAGG-3’) and H3
reverse (5’-GGATGGCGCACAGGTTGG
TGTC-3’). The DNA sequence of the histone
H3 gene from C. gigas was deposited in
the GenBank Database with the following
accession number: HQ009488. The histone
H3 gene sequence in C. gigas was analysed

Comp. Cytogenet., 2010 4(2)

113

for similarity with other known sequences
using the National Centre for Biotechnology
Information Blast database tool (http://www.
ncbi.nlm.gov/Blast/). CLC Sequence Viewer
version 6.2 (http://www.clcbio.com) was
used to aligne the sequence with other histone
H3 gene sequences and for phylogenetic
reconstruction. A total of 42 histone H3 gene
sequences were used for phylogenetic analysis
(Table 1). Distance-tree was constructed with
the Neighbour-Joining (NJ) algorithm (Saitou,
Nei, 1987), 100 bootstrap replicates. Bootstrap
values lower than 50% were not shown.

Chromosome preparations. Chromosome
preparations were made as described in Bouilly
et al. (2008). Briefly, 6 hours old embryos were
treated with 0.005% colchicine in seawater for
25 min. A hypotonic shock was applied for 10
min in 0.9% sodium citrate. Then, embryos
were fixed in 3:1 absolute ethanol-acetic acid
solution. Embryos cells were dissociated in
50% acetic acid and the suspension obtained
was dropped onto slides heated at 42°C and
air-dried.

Fluorescence in situ hybridisation
(FISH). Chromosome spreads were pretreated
with 0.005% pepsin in 10 mM HCI at 37°C
for 5 min and air-dried. Slides were then fixed
with formaldehyde as described in Chaves et
al. (2002). Briefly, slides were rinsed twice in
phosphate-buffered saline (PBS) for 5 min,
and after incubation in 1% formaldehyde in
PBS, for 20 min at room temperature, they
were washed twice in PBS for 5 min. The
slides were then dehydrated in a chilled ethanol
series (70%, 90%, and 100%; 5 min each) and
air-dried. Slides were aged overnight at 65°C,
and then, dehydrated in 100% ethanol at —20°C
for 3 min. Chromosomes preparations were
denaturated at 72°C in 70% formamide in 2 x
SSC for 2 min, followed by dehydratation in
70%, 90%, and 100% chilled ethanol, for 5 min
each. The probe was denaturated at 80°C for

vaN Comparative
\4 Cytogenetics

114 K, Bouilly et al.

Table 1. List of histone H3 gene sequences in different molluscan species used for the phylogenetic analysis
with GenBank accession numbers.
Species ree
HQ009488
A Y07015
: AY26774
, AY26774
, 1758 AY26774

lass Family

Mollusca|Bivalvia Ostreidae 1793

—

b)

()
er)
oO
DR
RN
ie
°
n —}

Mytilidae

N

SISTS 219
R/S) 72/8
S(SI/S 18 |S
Ala |G >
alolof& Is
R/S /s (Sle
STS {LIS
So Riche Pace bog
als |O |? (eg.
r|2./= |o Io
Siz is | {8
‘1B 128 [8
eee ee
EIS O12 18
Es|s Islz
od bt Pond Pe
BIE. [oo (9
—
oO
Go
Q

>
re
N
nN
XQ
a)
AK
CO }]\O

§
~
=
~A
i0he)
=
>
AS
S
S
=
x
2
g
=
~A
=
pa)
=
=
Oo
aa

9

1819
h AY 26774

imaria hemphilli Hertlein & Strong, [EU379502
1946

~

EU379493
EU379537

aevichlamys irregularis Sowerby,
1842
Carol
II, 1842

atinopecten caurinus Gould, 1850

Pectinoida

S
=~
iS
=
g
S
=
S.
S
dv
S
S
5
Ss
3
n
©
=
g
or
<
tJ
ce
8)
~3
Ns)
nN
S
Nn

FJ263662
FJ263666
EU379496
EU379538
Y07015
Amusium pleuronectes Linnaeus, 1758 }|EU379523
odipecten subnodosus Sowerby, 1835 |EU379535
, 1758 AY07015
Aequipecten opercularis Linnaeus, 1758 |EU3795 16
eptopecten bavayi Dautzenberg, 1900 |EU379487
Antigona lamellaris Schumacher, 1817 |DQ184882
, 1758 FJ429106
j 1828

Argopecten gibbus Linnaeus, 1758
E'uvola ziczac Linnaeus, 1758
ecten jacobaeus Linnaeus, 1758

>

AK

SEER PERSRES EES SEs
= S g =
2 3 S >=
SS ‘Ss Q a
> = g >
S ca 9 =
KS g x a
a ~ S =
S g. SS =
: : s| S/F
y Zz S 2
S: = " E
—

5 cy 2 e
B * 5 2
(oe)
5 a pe a
Q oS

lon —

(oe)

—

\O

Veneroida

=
~
S$
a
2.
=
&
~
=
a fe
2.
C
5
5
pee)
O
lo
NM

Q
g
ind
9
i)
>
i)
=
Lax)
ie)
=
>
ies)
>
&
~A
a
3
<

>

o)
2)
—
oo
rs
(oe)
\O
SIDI o \O

nsis ensis Linnaeus, 1758 Y07015
haxas pellucidus Pennant, 1777 DQ28000
bra prismatica Montagu, 1808 AY07016
ardita calyculata Linnaeus, 1758 AY07015

AB439267

emelidae
arditidae

iS
x

ettastomella japonica Yokoyama,

1920
Myidae fya arenaria Linnaeus, 1758

Gastropoda |Caenogastropoda |Sorbeoconcha |Turridae

AY07016
EU015786
EU015832

2

Habe, 1952

trema sp. EU015800
EU015823
EU015813
EU015856

DQ093507

Raphitoma sp.
OFS
ittorina littorea Linnaeus, 1758
Stomatella sp.

ittorinidae

Vetigastropoda
llidae

Trochidae ibbula zonata Wood, 1828

Astraea undosa Wood, 1829

AY92397
Y92398
; AY92398
Haliotis midae Linnaeus, 1758 AY923957

>

>
re
Ne}
SS
Uo
Ne}
~)
NIS|N oO KR

Pholadidae

SES OE ESIESES
S = S dq |>
i) B aS i RO
So tg Sy S/o
is S <= & |S
i) > = QS |o
3 is =. ah
S S ie S15
3 S/S S [5

: ie
= oO Se:
: Z 2/8
& a. So
fo) Re A \2
o =
n N =a Loe
a =. 6 jn
ms, em aA
oO = =
SB - &

No)
XQ

ete es Comp. Cytogenet., 2010 4(2)

Histone H3 gene in the Pacific oyster, Crassostrea gigas

20 40 60
| | |

cgqtaaatccact a caa ctccacgtaaacaact ctaccaa ccgqeccgtaagagcgcecccage
g 99499 99 g 99 99 g g gagcg 9g

80 100 120 140
| I | |

cactggtggagtcaagaaaccccacagatacaggcccggaaccgtcgctctccgtgagatcaggagatacc

160 180 200
| | |

agaaaagcacagagttgctcatcaggaaattgcccttccagegtctggtccgtgagattgctcaggacttc

220 240 260 280
| |

aagactgatctgcgattccagagctccgccgtcatggctctccaggaagccagcgaagcttaccttgttgg

300
|

LES

actctttgaggacaccaacctgtgcgccatcec

Fig. 1. Histone H3 gene sequence from Crassostrea gigas.

10 min and cooled immediately. Hybridisation
solution containing the denaturated probe was
dropped onto the denaturated spreads, the
slides were covered and kept overnight in a
humid chamber at 37°C. After hybridisation,
the slides were washed at 37°C once in 2 x
SSC for 5 min, then twice in 50% formamide
in 2 x SSC for 5 min, and once in 2 x SSC
for 5 min. The blocking agent was 3%
BSA, for 10 min at room temperature. The
digoxigenin-labelled-probe was detected with
anti-digoxigenin-rhodamine fab fragments
(Roche Molecular Biochemicals). The slides
were counterstained with DAPI and mounted
in Vectashield (Vector Laboratories).

Chromosome observation. Chromosomes
were observed with a Zeiss Imager.Z1
microscope coupled with an Axiocam digital
camera and a Zeiss LSM Image Browser
software. Digitised photos were prepared for
printing in Adobe Photoshop (Version 9.0);
contrast and color optimisation were the
functions used and all affected the whole of
the image equally.

RESULTS AND DISCUSSION

Molecular characterisation. A histone
H3 gene sequence in C. gigas with a size of
approximately 300 base pairs was isolated and
sequenced. A contig was produced using Vector

Comp. Cytogenet., 2010 4(2)

NTI Advance 10. The length of this contig
was 326 bp. Primers were aligned with the
contig and unalignable regions were excluded
from phylogenetic analysis. These included
positions | to 3 and 320 to 326. The sequence,
after analysis, was 316 base pairs long (Fig.1).
The analysis of C. gigas H3 gene sequence
using NCBI Blast database tool showed a high
similarity with H3 gene sequence in different
mollusc species. For example, C. gigas H3
gene had 87% similarity with O. edulis H3
gene (AY070151). The GC content (56.3%)
was higher than the AT content (43.7%).
The histone H3 gene sequence from C. gigas
and other histone H3 gene sequences were
reduced to 305 bp for phylogenetic analysis
to have a good alignment with the 41 histone
H3 gene sequences selected from GenBank
Database. The NJ tree separated the species
into two clades (Fig. 2).The first clade was
subdivided into two groups, one constituted
of 20 Bivalvia (12 Pectinidae, 5 Mytilidae,
2 Ostreidae and 1 Limidae) all from the
subclass Pteriomorphia, and the other one of 5
Gastropoda (corresponding to the superorder
of Vetigastropoda), and 7 Bivalvia (all
Heteroconchia: 4 Veneroida, 2 Myoida, except
one which was Pteriomorphia: | Limoida).

In bivalves, phylogenetic relationships
with histone H3 gene sequences have already
been studied in Pectinidae (Puslednik, Serb,

Comparative
4 Cytogenetics

A

116

73 Ensis ensis
# Phaxas pellucidus
Abra prismatica

Turris babylonia
Cinguloterebra cf. fujitai
100, Tritonoturris sp.
63 Raphitoma sp.
190 Etrema sp.
Conus gauguini
Littorina littorea
Cardita calyculata

* Ctenoides annulata

Stomatella sp.
Gibbula zonata
Homalopoma maculosa
Astraea undosa
* Haliotis midae
Meretrix meretrix
Antigona lamellaris
Glauconome chinensis
Nettastomella japonica
Mya arenaria

53
100

63

Ostrea edulis
Crassostrea gigas
Limaria hemphilli
ioor* Laevichlamys irregularis
57 Coralichlamys madreporarum
Patinopecten caurinus
+ Chlamys islandica
Argopecten gibbus
Euvola ziezac
74 Pecten jacobaeus
ae Amusium pleuronectes
7 Nodipecten subnodosus
7 root Mimachlamys varia
Aequipecten opercularis

K, Bouilly et al.

Mytilus chilensis
Mytilus californianus
Mytilus edulis
Mytilus galloprovincialis
Mytilus trossulus

Leptopecten bavayi

0,060
———__ Mm oe —

Fig. 2. The phylogenetic relationships among different molluscan species, as analysed by the Neighbour-
Joining method. Bootstrap values over 50% are written above the branches. Bar = Substitutions/Site.

2008), in Veneridae (Kappner, Bieler, 2006),
and in Mytilidae (Eirin-Lopez et al., 2004).
Unfortunately, little knowledge was available
concerning Ostreidae as until now only two
sequences of histone H3 gene were available
in oysters, the one from O. edulis and the one
from C. gigas (this study). Ostreida, Mytiloida,
Pectinoida and Limoida are from the same
subclass: Pteriomorphia, therefore it was
expected to find them in the same clade. The
other Limoida (Ctenoides annulata Lamarck,
1819) was found in another clade which was
unexpected, but it was also not supported by

? Comparative

Q4 Cytogenetics

a significative bootstrap value. The closest
relative of this Limoida was a Veneroida.
This Limoida was also closest to a group of
Vetigastropoda species (representatives of
another class, Gastropoda). The bootstrap
values were not significative, thus, no
relationships between these different species
can be established. C. gigas was more closely
related to O. edulis which is a predictable
result as they both belong to the same family
Ostreidae, and also to different Mytilidae
species: Mytilus californianus Conrad, 1837,
M. chilensis Hupé, 1854, M. edulis Linnaeus,

Comp. Cytogenet., 2010 4(2)

Histone H3 gene in the Pacific oyster, Crassostrea gigas

1758, M. galloprovincialis, and M. trossulus
Gould, 1850. However, O. edulis seems to be
more closely related to species of the genus
Mytilus than to C. gigas which is a species
from the same family. The reason for this
peculiar result could be the short length of
the sequence (only around 300 bp) used for
the reconstruction. Eirin-Lopez et al. (2004)
studied 5 Mytilidae, the same sequences that
we Selected in GenBank Database. The results
observed by Eirin-Lopez et al. (2004) were
quite similar to the ones observed in this study
as they showed that the 5 Mytilus species:
M. californianus, M. edulis, M. chilensis,
M. galloprovincialis and M. trossulus were
clustered together.

According to the phylogenetic tree some
closely related species were not clustered
together. The partial sequence of histone H3
gene seems to be too short to give a good
resolution in phylogenetic reconstructions.
Indeed, some groups were not supported by
a significative bootstrap value, and thus, H3
gene did not allow reconstructing an accurate
phylogeny as the different clusters not always
correspond to the taxonomical (family level or
class level) groups.

Cytogenetic characterisation. We
examined 80 good chromosome spreads from
oyster embryos. Our results showed that the
histone H3 gene was mapped at two different
loci in the genome of C. gigas (Fig. 3). The
histone H3 gene was located at an interstitial
site (about half-way from the centromere to
the telomeres) on the long arm of chromosome
pair 4, and on the telomeres of the smaller
chromosome pair (pair 10). Polymorphism
was detected on the telomeres of pair 10. On
the 80 metaphases that were examined, 16
presented single signals in both chromosomes
(20%) (Fig. 3, A-B), 29 showed double signals
(36%) (Fig. 3, C-D), and 35 had a single signal
on one chromosome and a double signal on the

Comp. Cytogenet., 2010 4(2)

LAZ

homologue (44%) (Fig. 3, E-F). The histone
H3 gene is a qualified chromosomal marker.
In other bivalve species, histone genes
were also localised in one, two or three
loci. In Mytilidae, FISH results on Mytilus
galloprovincialis chromosomes located core
histone genes at two loci in two different
chromosome pairs (Eirin-Lopez et al.,
2004), and the linker histone H1 probe at
three loci in three chromosome pairs (Eirin-
Lopez et al., 2002). In both experiments, the
hybridisation signals mapped the histone
genes at telomeric chromosomal positions or
interstitial positions. In Pectinidae, histone H3
gene was mapped at two loci in the genome
of Patinopecten yessoensis or a single locus
in the genome of Chlamys farreri, Chlamys
nobilis, and Argopecten irradians (Zhang et
al., 2007). Positions were also interstitial or
telomeric as in our experiment. In Mytilidae
and Pectinidae studies, no polymorphism
was reported. Histone gene clusters were
rather conservative in chromosome location
in most cases where closed species have been
analysed (Hankeln et al., 1993; Ranz et al.,
2003; Cabrero et al., 2009). Chromosomal
localisation of histone H3 gene should be
determined in other Crassostrea species for
oyster comparative studies. Histone H3 gene
in O. edulis was characterised molecularly
(Giribet, Distel, 2003), but no cytogenetic
studies were realised with this sequence.
Major ribosomal DNA genes (Xu et al.,
2001; Wang et al., 2004), NORs (Thiriot-
Quiévreux, Insua, 1992) and C-bands (Bouilly
et al., 2008) were also localised on the
telomeres of long arm of pair 10 in C. gigas.
During mitosis, the major ribosomal genes
are the nucleotidic component of the NORs
(Goessens, 1984), therefore, the chromosomal
sites of major ribosomal gene clusters
correspond to NOR sites. NOR sites were
already detected to colocalise with C-banded

vaN Comparative
\4 Cytogenetics

118

K, Bouilly et al.

Fig. 3, A-F. FISH with histone H3 gene probe applied on chromosomes of Crassostrea gigas (in red). The
chromosomes were contrasted with DAPI (blue). A - a metaphase cell with single/single signals on telomeres of
pair 10, and B - its corresponding karyotype. C - a metaphase cell with double/double signals on telomeres of pair
10, and D - its corresponding karyotype. E - a metaphase cell with single/double signals on telomeres of pair 10,

and F - its corresponding karyotype. Bars = 10 um.

heterochromatic region in an insect Bradysia
hygida Sauaia et Alves, 1968 (Gaspar et al.,
2002). In salmonids, the chromosomal location
of the major histone cluster was adjacent or
close to regions with C+ heterochromatin
(Pendas et al., 1994). Histone genes were
already found to be associated with 5S rDNA
in two Crustacean species, Artemia salina

Comparative

A

4 Cytogenetics

Linnaeus, 1758 (Andrews et al., 1987) and
Asellus aquaticus Linnaeus, 1758 (Barzotti et
al., 2000). Multicolour-FISH will be of great
interest to check if the major and minor rDNA
genes are colocalised or not with the histone
H3 genes in C. gigas.

In conclusion, histone H3 gene is a useful
karyotypic marker which can be used in

Comp. Cytogenet., 2010 4(2)

Histone H3 gene in the Pacific oyster, Crassostrea gigas

oyster cytotaxonomy. Our data support that
molecular and cytogenetic characterisations
of histone H3 gene in other oyster and bivalve
species will be useful for comparative studies,
evolutionary and phylogenetic studies, and
for understanding genome organisation in
oysters.

ACKNOWLEDGEMENTS

This work was supported by the project
PTDC/MAR/66143/2006 and a post-doc grant
SFRH/BPD/20538/2004 of the Science and
Technology Foundation (FCT) from Portu-
gal and also by the project FCOMP-01-0124-
FEDER-007377 of the European Fund of Re-
gional Development (FEDER). We are deeply
grateful to A. Benabdelmouna for providing
the fixed embryos of C. gigas.

REFERENCES

Andrews M.T., Vaughn J.C., Perry B.A., Bagshaw
J.C. 1987. Interspersion of histone and 5S genes
in Artemia // Gene. 51(1): 61-67. http://dx.doi.
org/10.1016/0378-1119(87)90474-4

Barzotti R., Pelliccia F., Bucciarelli E., Rocchi A.
2000. Organization, nucleotide sequence, and
chromosomal mapping of a tandemly repeated
unit containing the four core histone genes and a
5S rRNA gene in an isopod crustacean species //
Genome. 43(2): 341-345. http://dx.doi.org/10.1139/
gen-43-2-341

Boudry P., Heurtebise S., Lapégue S. 2003.
Mitochondrial and nuclear DNA sequence variation
of presumed Crassostrea gigas and Crassostrea
angulata specimens: a new oyster species in Hong
Kong? // Aquaculture. 228(1-4): 15-25. http://
dx.doi.org/10.1016/S0044-8486(03)00443-5

Bouilly K., Leitéo A., Chaves R., Guedes-Pinto H.
2005. Endonuclease banding reveals that atrazine-
induced aneuploidy resembles spontaneous
chromosome loss in Crassostrea gigas // Genome.
48(1): 177-180. http://dx.doi.org/10.1139/g04-087

Bouilly K., Chaves R., Leitao A., BenabdelmounaA.,
Guedes-Pinto H. 2008. Chromosomal organization
of simple sequence repeats in the Pacific oyster

Comp. Cytogenet., 2010 4(2)

119

(Crassostrea gigas): (GGAT),, (GT), and (TA),,
chromosome patterns // J. Genet. 87(2): 119-125.
http://dx.doi.org/10.1007/s12041-008-0018-2

Cabrero J., Lopez-Leén M.D., Teruel M., Camacho
J.P.M. 2009. Chromsome mapping of H3 and
H4 histone gene clusters in 35 species of acridid
grasshoppers // Chromosome Res. 17(3): 397-404.
http://dx.do1.org/10.1007/s10577-009-9030-5

Chaves R., Adega F., Santos S., Guedes-Pinto H.,
Heslop-Harrison J.S. 2002. /n situ hybridization
and chromosome banding in mammalian species //
Cytogenet. Genome Res. 96(1-4): 113-116. http://
dx.doi.org/10.1159/000063020

Clabby C., Goswami U., Flavin F., Wilkins N.P.,
Houghton J.A., Powell R. 1996. Cloning,
characterization and chromosomal location of a
satellite DNA from the Pacific oyster, Crassostrea
gigas // Gene. 168(2): 205-209. http://dx.doi.
org/10.1016/0378-1119(95)00749-0

Colgan D.J., Ponder W.F., Eggler P.E. 2000. Gastropod
evolutionary rates and phylogenetic relationships
assessed using partial rDNA and histone H3
sequences // Zool. Scr. 29(1): 29-63. http://dx.doi.
org/10.1046/j.1463-6409.2000.00021.x

Cross L, Vega L., Rebordinos L. 2003. Nucleolar
organizing regions in Crassostrea angulata:
chromosomal location and polymorphism = //
Genetica. 119(1): 65-74. http://dx.do1.org/10.1023/
A:1024478407781

Cross I., Diaz E., Sanchez I., Rebordinos L. 2005.
Molecular and cytogenetic characterization of
Crassostrea angulata chromosomes // Aquaculture.
247(1-4): 135-144. — http://dx.doi.org/10.1016/j.
aquaculture.2005.02.039

Eirin-Lépez J.M., Gonzalez-Tizon A.M., Martinez
A., Méndez J. 2002. Molecular and evolutionary
analysis of mussel histone genes (Mytilus spp.):
possible evidence of an “orphon origin” for H1
histone genes // J. Mol. Evol. 55(3): 272-283. http://
dx.doi.org/10.1007/s00239-002-2325-1

Eirin-Lépez J.M., Ruiz M.F. Gonzalez-Tizon
A.M., Martinez A., Sanchez L., Méndez J.
2004. Molecular evolutionary characterization of
the mussel Mytilus histone multigene family: first
record of a tandemly repeated unit of five histone
genes containing an H1 subtype with “orphon”
features // J. Mol. Evol. 58(2): 131-144. http://
dx.doi.org/10.1007/s00239-003-253 1-5

Gaspar V.P., Borges A.R., Fernandez M.A. 2002.
NOR sites detected by Ag-DAPI staining of an

? Comparative

\4 Cytogenetics

120

unusual autosome chromosome of Bradysia hygida
(Diptera: Sciaridae) colocalize with C-banded
heterochromatic region // Genetica. 114(1): 57-61.
http://dx.doi.org/10.1023/A:1014698401988

Giribet G., Distel D.L. 2003. Bivalve phylogeny
and molecular data, (pp. 45-90) // Lydeard C.,
Lindberg D.R. (Eds). Molecular systematics
and phylogeography of mollusks. Washington:
Smithsonian Books. 328p.

Goessens G. 1984. Nucleolar structure // Int. Rev.
Cytol. 87: 107-158. http://dx.doi.org/10.1016/
S0074-7696(08)62441-9

Guo X., Allen S.K. Jr 1997. Fluorescence in situ
hybridization of vertebrate telomere sequence to
chromosome ends of the Pacific oyster, Crassostrea
gigas Thunberg // J. Shellfish Res. 16(1): 87-89.

Hankeln T., Keyl H.G., Ross R., Schmidt E.R.
1993. Evolution of histone gene /oci in chironomid
midges // Genome. 36(5): 852-862. http://dx.doi.
org/10.1139/g93-113

Kappner L., Bieler R. 2006. Phylogeny of venus clams
(Bivalvia: Venerinae) as inferred from nuclear and
mitochondrial gene sequences // Mol. Phylogenet.
Evol. 40(2): 317-331. http://dx.do1.org/10.1016/j.
ympev.2006.02.006

Leitéo A., Chaves R. 2008. Banding for chromosomal
identification in bivalves: A 20-year history // Dyn.
Biochem. Process Biotechnol. Mol. Biol. 2 (special
issue 1): 44-49. http://www.globalsciencebooks.
info/JournalsSup/O8 DBPBMB 2 SI1.html

Leitao A., Chaves R., Santos S., Guedes-Pinto H.,
Boudry P. 2004. Restriction enzyme digestion
chromosome banding in Crassostrea and Ostrea
species: comparative karyological analysis within
Ostreidae // Genome. 47(5): 781-788. http://dx.doi.
org/10.1139/g04-035

Leitao A., Chaves R., Santos S., Guedes-Pinto H.,
Boudry P. 2007. Interspecific hybridization in
oysters: restriction enzyme digestion chromosome
banding confirms Crassostra angulata x
Crassostrea gigas F1 hybrids // J. Exp. Mar. Biol.
Ecol. 343(2): 253-260. http://dx.do1.org/10.1016/j.
jembe.2006.12.007

Loépez-Flores IL, de la Herran R., Garrido-Ramos
M.A., Boudry P., Ruiz-Rejon C., Ruiz-Rejon
M. 2004. The molecular phylogeny of oysters
based on a satellite DNA related to transposons //
Gene. 339: 181-188. http://dx.doi.org/10.1016/j.
gene.2004.06.049

Maxson R., Cohn R., Kedes L., Mohun T. 1983.

? Comparative

Q4 Cytogenetics

K, Bouilly et al.

Expression and organization of histone genes
// Annu. Rev. Genet. 17: 239-277. http://dx.doi.
org/10.1146/annurev.ge.17.120183.001323

Miller D.J., Harrison P.L., Mahony T.J., McMillan
J.P., Miles A., Odorico D.M., ten Lohuis M.R.
1993. Nucleotide sequence of the histone gene
cluster in the coral Acropora formosa (Cnidaria;
Scleractinia): Features of histone gene structure
and organization are common to diploblastic and
triploblastic metazoans // J. Mol. Evol. 37(3): 245-
253. http://dx.do1.org/10.1007/BF00175501

Pendas A.M., Moran P., Garcia-Vazquez E. 1994.
Organization and chromosomal location of the
major histone cluster in brown trout, Atlantic salmon
and rainbow trout // Chromosoma. 103(2): 147-152.
http://dx.do1.org/10.1007/BF00352324

Puslednik L., Serb J.M. 2008. Molecular phylogenetics
of the Pectinidae (Mollusca: Bivalvia) and effect of
increased taxon sampling and outgroup selection
on tree topology // Mol. Phylogenet. Evol.
48(3): 1178-1188. — http://dx.doi.org/10.1016/j.
ympev.2008.05.006

Ranz J.M., Gonzalez J., Casals F., Ruiz A. 2003.
Low occurrence of gene transposition events during
the evolution of the genus Drosophila // Evolution.
57(6): 1325-1335. http://dx.doi.org/10.1111/j.0014-
3820.2003.tb00340.x

Reese K.S., Cordes J.F., Stubbs J.B., Hudson K.L.,
Francis E.A. 2008. Molecular phylogenies help
resolve taxonomic confusion with Asian Crassostrea
oyster species // Mar. Biol. 153(4): 709-721. http://
dx.doi.org/10.1007/s00227-007-0846-2

Saitou N., Nei M. 1987. The neighbor-joining method:
A new method for reconstructiong phylogenetic
trees // Mol. Biol. Evol. 4(4): 406-425. http://mbe.
oxfordjournals.org/cgi/content/abstract/4/4/406

Thiriot-Quiévreux C., Insua A. 1992. Nucleolar
organizer region variation in the chromosomes
of 3 oyster species // J. Exp. Mar. Biol. Ecol.
157(1): 33-40. — http://dx.doi.org/10.1016/0022-
0981(92)90072-I

Thoma F., Koller T., Klug A. 1979. Involvement of
histone H1 in the organization of the nucleosome and
of the salt-dependent superstructures of chromatin //
J. Cell Biol. 83(2): 403-427. http://www.ncbi.nlm.
nih.gov/pmc/articles/PMC2111545/

Wang Y., Guo X. 2001. Chromosomal mapping of the
vertebrate telomeric sequence (TTAGGG). in four
bivalve molluscs by fluorescence in situ hybridi-
zation // J. Shellfish Res. 20(3): 1187-1190.

Comp. Cytogenet., 2010 4(2)

Histone H3 gene in the Pacific oyster, Crassostrea gigas

Wang Y., Xu Z., Guo X. 2001. A centromeric satellite
sequence in the Pacific oyster (Crassostrea gigas
Thunberg) identified by fluorescence in situ
hybridization // Mar. Biotechnol. 3(5): 486-492.
http://dx.doi.org/10.1007/s10126-001-0063-3

Wang Y., Xu Z., Guo X. 2004. Differences in the rDNA-
bearing chromosome divide the Asian-Pacific and
Atlantic species of Crassostrea (Bivalvia, Mollusca)
// Biol. Bull. 206: 46-54. http://www.biolbull.org/
cgi/content/abstract/206/1/46

Wang Y., Xu Z., Guo X. 2005a. Chromosomal mapping
of 5S ribosomal RNA genes in the Eastern oyster,
Crassostrea virginica Gmelin by fluorescence in situ
hybridization // J. Shellfish Res. 24(4): 959-964.

Wang Y., Xu Z., Pierce J.C., Guo X. 2005b.
Characterization of Eastern oyster (Crassostrea
virginica Gmelin) chromosomes by fluoresence
in situ hybridization with bacteriophage P1 clones
/! Mar. Biotechnol. 7(3): 207-214. http://dx.doi.
org/10.1007/s10126-004-005 1-y

Comp. Cytogenet., 2010 4(2)

121

Xu Z., Guo X., Gaffney P.M., Pierce J.C. 2001.
Chromosomal location of the major ribosomal RNA
genes in Crassostrea virginica and Crassostrea
gigas // Veliger. 44(1): 79-83.

Zhang L., Bao Z., Wang S., Huang X., Hu J.
2007. Chromosome rearrangements in Pectinidae
(Bivalvia: Pteriomorphia) implied based on
chromozomal localization of histone H3 gene in
four scallops // Genetica. 130(2): 193-198. http://
dx.doi.org/10.1007/s10709-006-9006-8

Zhang Q., Yu G., Cooper R.K., Tiersch T.R. 1999.
Chromosomal location by fluorescence in situ
hybridization of the 28S ribosomal RNA gene of the
Eastern oyster // J. Shellfish Res. 18(2): 431-435.

Received September 23, 2010.
Accepted V.G. Kuznetsova, October 29, 2010.
Published December 30, 2010.

? Comparative

\4 Cytogenetics